Phenylpropanoids and polyketides
Medchemexpress LLC Benzoin (DL-Benzoin) | 119-53-9 | 100.0% | 100 G
Benzoin (DL-Benzoin) is a PI3Kα inhibitor that exhibits anticancer effects. It has been shown to inhibit the growth of the colon cancer cell line (HCT-116) with an IC50 of 2.12 mM. This product is for research use only and not sold to patients. Its chemical formula is C14H12O2, and it has a molecular weight of 212.25. It appears as a white to off-white solid.
- Exhibits anticancer effects.
- Inhibits the growth of colon cancer cell line (HCT-116).
- White to off-white solid appearance.
- Chemical formula C14H12O2.
- Molecular weight 212.25.
Electron Microscopy Sciences Benzoin Ethyl Ether (ethoxy phenylacetophenone) 50 GR
(ethoxy phenylacetophenone)
CAS #574-09-4 C₆H₅COCH(CO₂H₅)C₆H₅ F.W. 240.31
Melting point: 56-59°C (133-138 °F)
Medchemexpress LLC 2-phenylacetophenone | 451-40-1 | MFCD00003081 | 10g
2-Phenylacetophenone has broad-spectrum efflux pump inhibition activity 2-Phenylacetophenone is a benzoin derivative used as a photoinitiator in vinyl polymerization[1]
Medchemexpress LLC Anisoin 100g
Anisoin (4 4 -Dimethoxybenzoin) is a pre-chromatographic fluorogenic labelling reagent for (liquid chromatography) analysis of guanidino compounds (Ex/Em 325/435 nm)[1]
Medchemexpress LLC Ethanone, 2-hydroxy-1,2-diphenyl- | 119-53-9 | 99.95% | 500 G
Benzoin (DL-Benzoin) is a PI3Kα inhibitor with anticancer effects. It inhibits the growth of colon cancer cell line (HCT-116) and has antiproliferative activities.
- PI3Kα inhibitor
- Anticancer effects
- Inhibits the growth of colon cancer cell line (HCT-116)
- Antiproliferative activities
Cayman Chemical 3-hydroxy PuerarIn 10mg
An isoflavonoid with antioxidant activity; scavenges peroxynitrite, nitric oxide radicals, and total ROS (IC50s = 1.36, 1.13, and 6.51 µM, respectively)
Apexbio Technology LLC Puerarin 3681-99-0 50mg
Puerarin (CAS 3681-99-0) is an isoflavone compound isolated from the root of Pueraria lobata It exerts multiple pharmacological effects primarily through modulation of oxidative stress and inflammatory signaling pathways Puerarin has been reported to enhance myocardial perfusion protect against ischemic injury and regulate glucose and lipid metabolism in preclinical models Additionally it demonstrates neuroprotective properties including mitigation of neuronal damage associated with neurodegenerative conditions Puerarin is widely studied for its potential in cardiovascular metabolic and neurological disease research
Apexbio Technology LLC Puerarin 3681-99-0 10mg
Puerarin (CAS 3681-99-0) is an isoflavone compound isolated from the root of Pueraria lobata It exerts multiple pharmacological effects primarily through modulation of oxidative stress and inflammatory signaling pathways Puerarin has been reported to enhance myocardial perfusion protect against ischemic injury and regulate glucose and lipid metabolism in preclinical models Additionally it demonstrates neuroprotective properties including mitigation of neuronal damage associated with neurodegenerative conditions Puerarin is widely studied for its potential in cardiovascular metabolic and neurological disease research
Medchemexpress LLC Inactive ASO (in vivo) sodium | CCTATAGGACTATCCAGGAA | 5 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide (ASO), typically 20-30 bases long, designed to interfere with or regulate gene expression. This specific ASO serves as a negative control for Tofersen, as it is not targeted in the rodent genome.
- Oligonucleotide molecules
- Interferes with or regulates gene expression
- Not targeted in the rodent genome
- Serves as a negative control for Tofersen
- Features thiophosphate skeleton modification
- Includes MOE modification
- Contains 5' methylcytosine
Medchemexpress LLC Inactive ASO (in vivo) sodium | CCTATAGGACTATCCAGGAA | 1 MG
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide (ASO) used to interfere with or regulate gene expression. This ASO is not targeted within the rodent genome and serves as a negative control for Tofersen. It features thiophosphate skeleton modification and MOE modification, and its cytosine is 5' methylcytosine.
- Inactive Antisense Oligonucleotide (ASO)
- Negative control for Tofersen
- Thiophosphate skeleton modification
- MOE modification
- 5' methylcytosine as cytosine
- White to off-white solid appearance
- Purity of 92.18%
Selleck Chemical LLC Daidzein S1849-50mg
Daidzein is a natural isoflavone phytoestrogen found in Leguminosae used as a component of foods and dietary supplements Daidzein is a soy isoflavone which acts as a PPAR activator
Medchemexpress LLC Daidzein-4',7-diglucoside | 53681-67-7 | 99.7% | 578.52 | 5 MG
Daidzein-4',7-diglucoside is a natural product that can be isolated from *Radix puerariae*. It is intended for research use only.
- Isolated from *Radix puerariae*
- Appears as a solid
- Color is white to off-white
- Classified as a flavonoid and isoflavone
- Initial source is plants, Leguminosae, *Piptanthus nepalensis (Hook.) D. Don*
- Part of compound screening libraries
- Cited in one publication